As can be seen from the table the text "DNA" would be represented by the three numbers: 68, 78, 65. Normally a derivative of ASCII encoding is used - see the table below. How each numerical value is interpreted can potentially be different, and this is known as encoding. In the most widely used type of text files ("old school" text) each letter is represented by one byte (8 bits) = 256 possible symbols. Even worse there is no standard way to ignore this extra information - meaning an MS Word file CANNOT be used as input to our sequence analysis programs.ĭifferent interpretations of "plain text".A lot of irrelevant information is added (visualized below): We simply don't care if the DNA sequence is in BOLD or a fancy font.There exists a number of file formats that can contain text - usually in a nicely formatted matter, with embedded graphics and other fancy features. Rich text / MS Word / Word Perfect / etc. There are two main concerns when speaking about text files: ![]() How difficult can it be? Text is text, right? That way will be easy to use the data as input for different kinds of programs, and write simple scripts (small programs) that reads some kind of input, performs some sort of analysis and outputs the result in a readable manner. The main idea is to keep everything simple and open. The same approach is usually also used for other kinds or data - lists of gene names, statistics on DNA patterns etc. ![]() GCACCATGGCTCCGACCAGGTCCGCAACCACGGCAAGAAGGTGTTGGCCGCCTTGGGCAACGCTGTCAAGĪGCCTGGGCAACCTCAGCCAAGCCCTGTCTGACCTCAGCGACCTGCATGCCTACAACCTGCGTGTCGACCĬTGTCAACTTCAAGCTGCTGGCGCAGTGCTTCCACGTGGTGCTGGCCACACACCTGGGCAACGACTACACĬCCGGAGGCACATGCTGCCTTCGACAAGTTCCTGTCGGCTGTGTGCACCGTGCTGGCCGAGAAGTACAGA GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCCCACTTCGACTT For example:ĪTGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG In bioinformatics it's very common to have the data hosted in simple plain text format. 4.2 Search and Replace & Block selection.4.1 On file extensions and default programs.2.2 Different interpretations of "plain text".2 How difficult can it be? Text is text, right?.1 Background: data in plain text format.
0 Comments
![]() Participation from Market Makers and ECNs is strictly voluntary and as a result. ET) and the After Hours Market (4:00-8:00 p.m. Our research shows that the top 50% of the Zacks-ranked industries outperform the bottom 50% by a factor of more than 2 to 1. Investors may trade in the Pre-Market (4:00-9:30 a.m. In terms of the Zacks Industry Rank, Automotive - Original Equipment is currently in the bottom 33% of the 250 plus Zacks industries. Investors should be mindful of the fact that the outlook for the industry can have a material impact on the performance of the stock as well. The current consensus EPS estimate is -$0.22 on $16.37 million in revenues for the coming quarter and -$0.77 on $42.38 million in revenues for the current fiscal year. ) Non-GAAP adjustments: Stock-based compensation Stock-based compensation. It will be interesting to see how estimates for the coming quarters and current fiscal year change in the days ahead. You can see the complete list of today's Zacks #1 Rank (Strong Buy) stocks here. So, the shares are expected to perform in line with the market in the near future. While the magnitude and direction of estimate revisions could change following the company's just-released earnings report, the current status translates into a Zacks Rank #3 (Hold) for the stock. Investors can track such revisions by themselves or rely on a tried-and-tested rating tool like the Zacks Rank, which has an impressive track record of harnessing the power of earnings estimate revisions.Īhead of this earnings release, the estimate revisions trend for Luminar Technologies, Inc. Not only does this include current consensus earnings expectations for the coming quarter(s), but also how these expectations have changed lately.Įmpirical research shows a strong correlation between near-term stock movements and trends in earnings estimate revisions. NASDAQ does not use this value to determine compliance with the listing requirements.There are no easy answers to this key question, but one reliable measure that can help investors address this is the company's earnings outlook. ![]() "Market Cap" is derived from the last sale price for the displayed class of listed securities and the total number of shares outstanding for both listed and unlisted securities (as applicable). It does not include securities convertible into the common equity securities. Market Cap (Capitalization) is a measure of the estimated value of the common equity securities of the company or their equivalent. Register for your free account today at. Amy Smith - Luminar’s Head of Investor Relations. ![]() Data Link's cloud-based technology platform allows you to search, discover and access data and analytics for seamless integration via cloud APIs. (NASDAQ:LAZR) Q1 2023 Earnings Conference Call 5:00 PM ETCompany Participants. Real-time Data is provided using Nasdaq Last Sale Dataĭata provided by Nasdaq Data Link, a premier source for financial, economic and alternative datasets.Investors who anticipate trading during these times are strongly advised to use limit orders. Stock prices may also move more quickly in this environment. Participation from Market Makers and ECNs is strictly voluntary and as a result, these sessions may offer less liquidity and inferior prices. Investors may trade in the Pre-Market (4:00-9:30 a.m. This data feed is available via Nasdaq Data Link APIs to learn more about subscribing, visit Nasdaq Data Link's products page. Significantly high institutional ownership implies Luminar Technologies' stock price is sensitive to their trading actions A total of 7 investors have a majority stake in the company with 51. Real-time bid and ask information is powered by Nasdaq Basic, a premier market data solution. ![]() You can use the bid-ask spread to determine whether to place a market order or limit order when trading, helping you to optimize your price and have a successful order execution. In contrast, a larger spread suggests lower liquidity, as there are fewer investors willing to negotiate. Often, a smaller spread suggests higher liquidity, meaning more buyers and sellers in the market are willing to negotiate. The bid-ask spread can indicate a stock’s liquidity, which is how easy it is to buy and sell in the marketplace. The data displayed in the quote bar updates every 3 seconds allowing you to monitor prices in real-time. The bid size displays the total amount of desired shares to buy at that price, and the ask size is the number of shares offered for sale at that price. The numbers next to the bid/ask are the “ size”. amount that a seller is currently willing to sell. The bid is the highest amount that a buyer is currently willing to pay, whereas the ask is the lowest The bid & ask refers to the price that an investor is willing to buy or sell a stock. I feel like the coronavirus coupled with everything we've been seeing out on the streets, on a civil rights front, has exposed a lot of cracks in a system that feels in pretty dire need of repair. And it felt like that to me even before this past year. Trying to keep steady in a world that feels so chaotic. And it looks different than what it would look like I think if I didn't have kids. I'm a dad, my kids are almost 8 and 12, and so I feel like I kind of see the world a lot of times through their eyes. Questions about our obligations to one another. MT: Like I mentioned a couple minutes ago, questions about spirituality and what place that occupies in my life. IF YOU FEEL COMFORTABLE SHARING, I'D LOVE TO HEAR ABOUT THAT, AND YOUR PROCESS FROM FEELINGS TO WRITING. ![]() WHAT ARE TYPICALLY THE SORTS OF TOPICS YOU WRITE YOUR MUSIC ABOUT? I SEE A LOT OF EMOTIONAL LYRICS WITHIN YOUR MUSIC. So, I had a lot of time to sit with my thoughts and my instruments and come up with this thing that feels uninterrupted, maybe. I did a lot of writing that wasn't interrupted by having to play shows. I was just at home here, in this room I'm sitting in actually. But I think this record feels really condensed because I wasn't traveling at all. They're about questions about spirit, and about what our obligations are to each other as humans. MT: To be honest, I am continually working with the same themes on my records. HOW IS THIS DIFFERENT FROM THE REST OF DISCOGRAPHY? WHAT'S SPECIAL ABOUT THIS ALBUM? THE BAND HAS A NEW ALBUM RELEASING IN JUNE WHICH I READ IS KIND OF A PICTURE OF YOUR LIFE THESE PAST 5 YEARS. I think we need to find those places, certainly right now. But I think it's important to do that, to be able to do that, or start to do that. Speaking truth out into the world, standing up for what you really think and not backing down from that can put you in a vulnerable place. I think part of the inspiration for that song was the ways of telling the truth and speaking the truth. THE BAND'S TOP SONG, "SANCTUARY" THAT WE PLAY ON WERS, CAN YOU TALK A LITTLE BIT ABOUT THE INSPIRATION AND DRIVE BEHIND THAT ONE? People aren't really going to mistake my music for reggae, but that's what I listen to a lot of. That's stuff I feel really connected to and that sort of musical influence comes into my own music in sideways ways. Everybody from King Tubby to Freddie McGregor to Marsha Griffiths, Cornell Campbell. That's what I spend most of my time listening to. ![]() You know, roots reggae which is kind of like devotional reggae or dub reggae. My favorite era is the 1970s-1980s which is most of what I listen to and buy. I think he was an amazing songwriter and had a really incredible touch when it comes to rhythm. MT: I love Curtis Mayfield, he's a really big one for me. WHO ARE SOME OF YOUR MUSICAL INSPIRATIONS OF THE PAST OR PRESENT? ![]() ![]() I get a lot of questions about it and I don't really have a great answer. It just kind of exists in this mysterious sort of universe. I was still playing in another band, so it was sort of my side thing. That's when the earliest Hiss Golden Messenger shows started happening. I started using the name probably about 2006 I would say. MT: It's a name that I came up with when I was still living in San Francisco at the time. HOW DID THE NAME HISS GOLDEN MESSENGER COME TO BE? I FIND IT VERY INTERESTING. Like when I make music and listen to my own music as I'm working on it, it has to feel emotionally believable to me. Soulful to me means something that feels emotionally genuine. But I feel like I am just trying to make music that feels soulful. I feel connected to some of that music, or parts of it. I understand why people say that it's folk or a lot of times Americana. I KNOW YOUR BAND'S GENRE LISTED ON MUSIC PLATFORMS IS FOLK, BUT IF YOU COULD PUT AN ADJECTIVE TO DESCRIBE YOUR TYPE OF FOLK MUSIC, WHAT WOULD THAT WORD BE? They talked about everything from the upcoming release to the band's origins, inspirations and musical process. Taylor recently sat down with staff writer Kelsey Sidman. North Carolina-based folk group Hiss Golden Messenger is set to release their latest studio album, Quietly Blowing It, next month. ![]() Once you order your truck, Stripes & Stuff can start helping you with your concept. You can order graphics through Stripes & Stuff and install them on your own if you wish. They collect half down to start the process, and the other half before your truck is delivered to Prime. Stripes & Stuff offers a few payment options, so you can set up an arrangement that works for you. How much does it cost to wrap a semi-truck? You may be looking at $3,000 to $4,000 depending on the design and style. If you want to add the name and logo of your LLC, that’s going to be around $140 to $180. Those that require more design work and cover a larger portion of the truck will be more expensive.Ī simple door name costs only $10. The cost of custom decals and graphics depends on the size of the project. Prime wants to ensure that graphics and themes are professional as each truck represents the company while crisscrossing the country hauling freight. ![]() Keep in mind that each custom design must be approved by Prime prior to Stripes & Stuff applying the graphics. These are just a few of the designs Prime drivers have created. A dedication to the 9/11 firefighters who lost their lives. The designers at Stripes & Stuff will work with you to fine tune and finalize your design.Ī mythical Kraken with tentacles wrapping around the truck. Need a graphic that matches your tattoo? Done. Want to put your grandchildren’s artwork on your truck? No problem. You can start with a simple sketch, artwork or an idea. What Decals & Graphics Can I Put on my Truck?įrom design to application, Stripes & Stuff has got you covered. ![]() Being an independent contractor at Prime gives you more say in which loads you run, the time you take off, and the truck you drive. The Success Leasing program offers standard lease and lease purchase options for those looking to become owner-operators. Once you lease for at least 3 months with Success Leasing, you can order a custom truck and choose the model and color of your truck, as well as the display graphics that express your personality. It’s one of the benefits of becoming an independent contractor. Who Can Customize Their Truck?Ĭustom semi-truck decals, wraps and lettering are reserved for independent contractors at Prime Inc. Whether you want to highlight your favorite cause, singer or TV show, Stripes & Stuff can bring your vision to life. We’ve worked with Stripes & Stuff for over three decades to help our independent contractors make their trucks unique. The best part? They’re located right down the road from our Springfield, MO terminal. Stripes & Stuff specializes in fleet graphics and detailing, offering custom wraps and decals for semi-trucks. At Prime, you can turn a simple idea into the truck of your dreams. Why not make it reflect you? Custom graphics show off your interests and personality. ![]() US07/496,596 Protective cover for slack adjusters
![]() ![]() You will not be able to move the pre-installed apps to sd card but this will give you room for alot more than what you had! If you do the entire card it will still show your internal as 16gb, and the size of your ext_sdcard, but when you click the 3 dot menu, the drop down will give an option to format as portable storage again if it worked. When you go back up under storage after these commands, especially if you do 50/50 or another percentage, that will show you it worked. Just make sure to let the phone format the sdcard first before running the commands or it will do so & restart your phone.Īlso if you go up under storage and see a "greyed out" usb card listing, just click on it and it will give you the option to "forget" it. Sm partition disk:179,64 private (or mixed 50 instead of private for 1/2 & 1/2) Does anyone know if it is possible to use this to achieve the 'Adoptable storage' feature? It was done following explicit instructions on how use the app to launch a hidden Android feature not readily available in the normal 'Settings' group to accomplished this. I have used an app called 'Activity Launcher' once in the past to disable the KnockON feature of the phone. Is there any 'Play-store' app that can do this? I have already tried App-Manager ApptoSD and it does not list any moveable apps.ĭoes anyone know of an elegant, easy way of doing this? Is this a hidden feature? Is it really NOT POSSIBLE to transfer or install apps to the SD Card? There is no 'Adoptable storage' anywhere that I can find. If I select the 'SD card' line it takes me to the folders that reside on the SD card. If this is selected it shows me what apps are installed, and when they are selected none show any facility for moving. If I select the 'Internal storage' line it takes me to summary's of what resides there including a selection 'Apps'. When I look in Settings\Storage & USB, it shows a line for 'Internal storage' and another under 'Portable storage' for the 'SD card' with an 'Eject' icon listed to the right. There is no facility that I can find anywhere for it. Most of the documentation I found for rooting the Optmius Hub isn't very complete or user-friendly.I too have the above stated predicament of not being able to install or transfer already installed apps to the external SD storage card (64GB) in my new LG Stlyo 2 (Virgin Mobile) running Marshmallow 6.0.1. It does look like rooting your phone could solve your problem, but I would recommend against doing so unless you really feel like you know what you're doing. A lot of recent phones have been shipping with very small internal storage, compared to, say, a 32GB SD card, and once they fill up it there isn't much to do about it. I'm pretty disappointed that they removed the ability to install apps to SD cards. I remember there used to be an option in the Application Settings page to move an app to SD card, but I checked on my phone and it looks like that option was removed a few versions ago. I went digging around in the Google Play settings and I couldn't find an option to set a default place to install apps. I've been looking at a few apps that advertise being able to move apps onto an SD card, but each I've tried requires root. This video in particular should be helpful for moving both files and apps to your SD card. ![]() Here's a list of YouTube videos that explain how to do this. This can be done by long pressing the folder/file name, selecting "move" from the options, and then navigating to the SD card and selecting "paste". that you don't want to delete, but don't want on your internal storage, you can use the file manager to move them. If there is a large group of music, pictures, etc. Once you have that installed you can look in your Downloads, Music, and DCIM (pictures) folders and see if there are any large files that you can delete. I'd recommend getting a file manager from the play store to see what is taking up so much space on your internal storage. The two solutions are to either migrate some of the data (photos, music, downloads, etc.) from your internal storage to your SD card, or move apps from your internal storage to SD card. Hi! This sometimes happens to me on my own phone. ![]() Luminar Neo also provides more complex tools, including layer functionality, transforming and cloning, and a collection of versatile AI enhancers. This photo editing software comes with all the photo editing for Mac features standard in any software, such as color correction, light and contrast adjustments, black&white converter, vignette, noise reduction, and many more. It has 60-plus tools and presets for maximum results with minimum time and tinkering. Why we love it: Luminar Neo is a creative photo editor based on Artificial Intelligence. So let's take a look right now at free photo editing software for Mac like Photoshop.Ĭhoose any of the options on this list and you’ll have yourself one of the best photo editors for your next project. Some are free trials of paid programs, and others are genuine, no-strings-attached free photo editors. Some of the winners on our list are available as desktop apps, while others are strictly available as online photo editors. We’ll let you know which platforms each app or program is compatible with in the “Where you can use it” section.) The Best Free Photo Editing Software for Mac Many of these will work for Windows, too. (Don’t worry, PC devotees - we won’t leave you high and dry when it comes to the best free image editors. Whether you need free, online versions or professional photo editors, you can easily get the one you want from the following material ![]() If you need to edit photos on your Mac, you can learn more about the best Mac photo editors recommended in the post. Take a look and get those JPEGs and RAW files queued up. To help you out, we’ve put together this list of the best free photo editing software for Mac. Mac image editing is very simple if you choose the right software. And ideally, you want to make that happen without spending a lot of time learning a new program or dropping a lot of money on software. The website claims that the games are 100% tested by their uploaders. Next on the list, we have Games Torrents, and as the heading suggests this gaming torrent site is ideal for the Spanish gamers out there.īefore downloading a game from Games Torrents you can acquire detailed information like the size of the game, supported platform, game format, and much more. Games Torrents (Best for Spanish Downloaders) Since GazellaGames is a member-only website it will never face a crackdown and go offline. GazellaGames features a clean and easy-to-navigate UI that makes the process of searching and downloading games quite straightforward. The content library of GazellaGames consists of over 60,000+ verified game torrents. Luckily, you can avoid the verification process by receiving an invitation from an existing member. ![]() The verification process might take a considerable amount of time but it ensures safety. In order to download/upload games on GazellaGames, you have to be a verified user. GazellaGames is another feature-packed game torrent website for downloading torrented games. GazellaGames (Reliable Site For Downloading Torrents) Overall, FitGirl is a trustworthy website for high-quality game torrents. Sadly, since the games are repacked it takes a considerable amount of time to install them. In addition to PC games, you can also download PS, Xbox, and Emulator games from FitGirl. You will be surprised to know that FitGirl Repacks has a humongous library of games spanning over 60 pages worth of repackaged games. As the name suggests, you can effortlessly download repacked games from FitGirl Repacks even if you have slow download speeds. FitGirl Repacks (Compressed Games For Quick Download)įirst, on the Best Game Download Torrent Sites list, we have the tried and trusted FitGirl Repacks. Which torrent site is best for mobile games?īest Game Torrent Sites 1.TorrentDownloads (Ultimate Game Torrent Resource) ![]() ![]() Kickass Torrents (Well-Established Game Torrenting Site) Skidrowcodex (Greate Game Torrent Resource) CroTorrents (Dedicate PC Gaming Torrent Site) The Pirate Bay (Huge Collection Of Game Torrents) FitGirl Repacks (Compressed Games For Quick Download) Access to Video Dashboard and sharing a recorded video has never been this easy in my life. So far never experienced a recording hiccups in terms of picture quality hence giving a big thumbs up on this feature. Very elegant software to use and I did not have to waste a single second to learn this fabulous software because it is quite user-friendly. My simple advice is, if you are into the educational sector and want to reach your students and teams, this is a must software in your office. Especially we have branches in our country, likewise outside the country therefore to educate my subordinates and students in onshore and offshore, I never had to book a time slot or think of geographical distance because Icecream software has enabled me to eliminate all these obstacles and record some quality videos. Since I am into the Educational sector, this has become a fundamental tool in my office. The user always has some sort of a worry whether the recording saves in a third party location or a drive, hence developers need to find a way to increase customer reliability and satisfaction for the recording videos. For example, you need to press Ctrl+Shift and C simultaneously just to do a copy. Shortcut keys can assign to keyboard letters rather than using multiple keys at once. Audio quality sometimes not smooth but this is an area where the developers can easily improve the quality of the audio output. Enable user to customize the region he wants to record, hence the user can utilize the other area to continue his other activities on PC. ![]() For Example whether to upload it to YouTube, google drive or Direct Dropbox. Once the recording is finished it quickly goes to a dashboard where it allows the user to decide how to deal with the final output. Does not interrupt your activity despite the recording has started, you will not even notice that there is a background recording occurring. Never encountered gaps in the recorded videos or any sort of a glitch. ![]() This software allows you to record your whole activity in your PC, without missing a single mouse pointer movement. I can assure you that this tool will never let you down. Simultaneously, inhibited repetition of training multiple times. Moreover, This software helped our company to save our expenses on Air Travel, taxi, accommodation, and insurance. There are many instances we had to utilize this tool to guide finance and operation teams which are located in various countries. Having this software helped to educate in house staff and staff who are located in different geographical areas and time zones. Sometimes the audio gets distorted when I edit the video, so I find it difficult to correct the segments I need. Likewise, it has very few video formats in any of its versions, so it is very limited in that aspect. It is almost useless in its free version, since it adds a watermark that reduces the professionalism of the video. Many new features for video editing have been added, so these improvements in the software are greatly appreciated. It is very intuitive in all its aspects, the edition is very friendly so I can have pretty decent results to be able to share my videos on a professional level without any problem. With Icecream Screen Recorder I can record all areas of my computer easily and convert videos to different formats, including MP4. I think that taking video is better than taking a thousand screenshots and a huge time saver at the end. It has helped me a lot for didactic exercises that I have done for my colleagues and clients, so I take the opportunity to add annotations and zoom in on the videos to improve the understanding of a process. But that's not an issue I can't work with. I would feel safer if this program included privacy settings. ![]() I can hardly find any issues with this software. This is the app I advise using if you need to record tutorial videos or programs that you want to watch again later. ![]() The recording equipment was rudimentary and user-friendly. I could submit my own work that I had recorded using this software to my YouTube channel, my colleagues, or brand-new recruits as a tutorial. I can act quickly thanks to the user-friendly UI if I want to take a screenshot of something or a crucial section of the videos I watch. I'm hoping you'll have the same outcomes as me. As a result, you can work more efficiently as you won't need to constantly remind yourself how to utilize the tools, as you would with more complex apps. With this program, you can complete your task quickly and effectively. It is an easy-to-use piece of software that lets you record anything you want in excellent quality. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |