As can be seen from the table the text "DNA" would be represented by the three numbers: 68, 78, 65. Normally a derivative of ASCII encoding is used - see the table below. How each numerical value is interpreted can potentially be different, and this is known as encoding. In the most widely used type of text files ("old school" text) each letter is represented by one byte (8 bits) = 256 possible symbols. Even worse there is no standard way to ignore this extra information - meaning an MS Word file CANNOT be used as input to our sequence analysis programs.ĭifferent interpretations of "plain text".A lot of irrelevant information is added (visualized below): We simply don't care if the DNA sequence is in BOLD or a fancy font.There exists a number of file formats that can contain text - usually in a nicely formatted matter, with embedded graphics and other fancy features. Rich text / MS Word / Word Perfect / etc. There are two main concerns when speaking about text files: ![]() How difficult can it be? Text is text, right? That way will be easy to use the data as input for different kinds of programs, and write simple scripts (small programs) that reads some kind of input, performs some sort of analysis and outputs the result in a readable manner. The main idea is to keep everything simple and open. The same approach is usually also used for other kinds or data - lists of gene names, statistics on DNA patterns etc. ![]() GCACCATGGCTCCGACCAGGTCCGCAACCACGGCAAGAAGGTGTTGGCCGCCTTGGGCAACGCTGTCAAGĪGCCTGGGCAACCTCAGCCAAGCCCTGTCTGACCTCAGCGACCTGCATGCCTACAACCTGCGTGTCGACCĬTGTCAACTTCAAGCTGCTGGCGCAGTGCTTCCACGTGGTGCTGGCCACACACCTGGGCAACGACTACACĬCCGGAGGCACATGCTGCCTTCGACAAGTTCCTGTCGGCTGTGTGCACCGTGCTGGCCGAGAAGTACAGA GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCCCACTTCGACTT For example:ĪTGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG In bioinformatics it's very common to have the data hosted in simple plain text format. 4.2 Search and Replace & Block selection.4.1 On file extensions and default programs.2.2 Different interpretations of "plain text".2 How difficult can it be? Text is text, right?.1 Background: data in plain text format.
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |