We call this new type of protection 'pro-active protection'. We vigorously test your proactive case to bring you the highest quality and most secure protection possible. Our best case EVER All new design with higher front bumper and more Get in the Loop today and StoptheDrop with our premium iPhone 12 Pro Max (6. Here are some of the details behind the design: 1) Durable, Crack Resistant Outer Shell. Here are some of the details behind the design:Ģ) Patented Interchangeable & Fully Adjustable Loops for easy changeabilityģ) All Ports Fully Accessible for all of your favorite accessories Weve designed Loopy from hundreds of reviews to bring you the best case possible, designed for you. We've designed our Loopy from hundreds of reviews to bring you the best case possible, designed for you. We've German-engineered Loopy to give it everything you could possibly want in a perfectly balanced slim case. The goal in creating Loopy was simple: make a proactive case that protects your phone better than the rest, yet doesn’t add unnecessary bulk. Loop圜ases Instant 20 Off Code: Join Loop圜ases' Email Newsletter and Get an Instant 20 Off Storewide Discount Code. Loopy Original - iPhone 14 Pro Max (6.7" Screen) Loop圜ases Coupon Code: Up To 15 Off Orders 80+ (Site-wide) w/Coupon Code.
0 Comments
![]() In addition to these subtle variations, you can choose between standing photo frames, magnetic frames and hanging frames. So, while you would naturally keep them open while displayed on a mid century sideboard or glass office desk, it’s great that they can be folded in case you need to pack them away for special occasions or for moving house. The other common feature you’ll find on a lot of these frames is that they’re foldable. In some of the more unique styles, the frames are double-sided. Some have two photo spaces on top of each other, while others are side by side. The other interesting variations you’ll find with these double photo frames is how they’re arranged. That way you can be sure you’ll be able to see all of the photo when it’s in the frame. It’s all down to personal preference really, but you can also carefully think about the pictures you’re going to display before buying. With plenty of variety on offer, here are some of your choices: You might find the entire piece is square in shape, but the cut-outs for your photos are oval. There are plenty to choose from, and some are a bit of a combination. The other great thing you can do is to choose your ideal shape. ![]() Whether you only want metal because you’ve got a very modern or industrial interior design, or perhaps you love natural materials like timber, eBay lets you filter searches easily. If you like having complete control over the materials in your decorative items, eBay makes it extremely easy. Want to capture some great memories and display them in your home? Pictures of your parents, or even you and a loved one together? Double photo frames make it easy! Double photo frames for your precious memories ![]() The ad and will run on sports and rock-themed radio stations in Detroit and Toledo, according to the spokesperson.īiden’s reelection campaign, criticizing what it deemed a “self-serving photo op,” said Monday night that Trump was going to Michigan to “pretend he didn’t spend his entire failed presidency selling (Michigan workers) out at every turn.” The ad tries to cast Trump as supportive of auto workers but doesn’t explicitly mention the strike. The Trump campaign on Tuesday started running a radio ad in Detroit and Toledo, Ohio, aimed at appealing to auto workers amid the ongoing strike, according to a Trump campaign spokesperson. Amid concerns about his electability beyond the GOP primary, his team is eager to pick off voters anywhere they perceive as potentially vulnerable for President Joe Biden. Trump’s visit to the swing state of Michigan signals a look ahead to the general election. “We can’t keep electing billionaires and millionaires that don’t have any understanding what it is like to live paycheck to paycheck and struggle to get by and expecting them to solve the problems of the working class.” “Every fiber of our union is being poured into fighting the billionaire class and an economy that enriches people like Donald Trump at the expense of workers,” Fain said in an emailed statement. UAW President Shawn Fain pushed back on the news of Trump’s upcoming speech. “The auto workers are being sold down the river by their leadership, and their leadership should endorse Trump,” the former president told NBC News in an interview last week. The news comes amid the ongoing United Auto Workers strike, which began last week after the union and the nation’s three largest automakers failed to reach a deal to avert it. His prime-time remarks will serve as counterprogramming to the September 27 debate at the Ronald Reagan Presidential Library in Simi Valley. Presumably, this includes the base game as well, but we’re not sure.Former President Donald Trump will skip the second Republican presidential primary debate in California next week and instead will travel to Detroit to deliver a speech to an audience that will include current and former union members, according to a source familiar with his plans. It’s unclear precisely how much room the expansion will take up on your PC, but CD Projekt Red says players will need at least 70GB of storage space. Phantom Liberty is not a standalone game, which means you will need to have Cyberpunk 2077 installed in order to play the expansion. Image source: CD Projekt Red File size and system requirements If you have a GOG account and some of CD Projekt Red’s other popular titles, you’ll also get the following goodies when you purchase the Cyberpunk 2077 expansion: Preorder bonuses for Cyberpunk 2077: Phantom Liberty. Here are the online retailers where you can preorder Phantom Liberty prior to launch:Įveryone who preorders Phantom Liberty will receive a Quadra Sport R-7 “Vigilante” vehicle. If you’re looking to deep dive into Dogtown as soon as it’s available, here’s a map with some global release timings! /5Q5diYtS5t The wait is almost over, chooms! □ #PhantomLiberty arrives on September 26th – 1 AM CEST on PC, and midnight local time on Xbox Series X|S and PlayStation 5. ![]() You can also grab a bundle with the full game and the expansion for around $80, but the price differs between digital stores. ![]() The expansion will not be available on PS4 and Xbox One, even though the original game is out on those platforms. Image source: CD Projekt RedĬyberpunk 2077: Phantom Liberty releases on September 26, 2023, on PS5, Xbox Series X/S, and PC for $29.99. Price, release date, preorder, and platforms Police chase in Cyberpunk 2077: Phantom Liberty. The expansion will introduce new skills and abilities, new weapons, new vehicles, new dynamic events throughout Night City, and an increased level cap of 60. You’ll team up with FIA agent Solomon Reed (played by Idris Elba) in order to rescue the president, who crash-landed in Dogtown after a missile hit her ship.ĬD Projekt Red describes Phantom Liberty as a “spy-thriller adventure” in which you’ll “infiltrate high-security buildings, take out enemies, and go toe-to-toe against seasoned professionals.” In addition to Reed, Hanson, and President Myers, the expansion will also introduce the netrunner Songbird and the shapeshifting FIA agent Alex Xenakis. The expansion is set in the district of Night City known as Dogtown, which is controlled by NUSA Colonel Kurt Hansen and his militia. Phantom Liberty is a single-player expansion for Cyberpunk 2077. ![]() Let me know if any additional information or videos is needed. Its as if Jon Woo directed The Matrix when you play, a multiplayer mod for.What I described isnt some rare occurrence in Double Action Boogaloo. I pulled up the scoreboard while recording, so it shows the server information as well. *Edit: Here's one of many videos I recorded. I'm loving the game so far (I just started playing a few days ago), and the presence of this aimbotter/cheater, along with the faultiness of the current voting system, are the only gripes I have everything else is great, and I thank the developers for offering such a fun game for free. The voting window comes and goes so quickly that it is very easy for players to miss out, which can make or break a particular vote. ![]() Secondly, I've noticed on a number of occasions that the voting system seems faulty in itself - for example, I've seen 8 people vote to kick a user, with 0 votes against kicking them, and the vote will fail with the message "Vote failed, votes in favor must be greater than votes against."Īnother aspect of the system's faultiness is the very short length of time which a particular vote is active. This is clearly a fault in the current voting system which the player was aware of, and exploiting to their advantage. Theres no finesse involved in throwing yourself at somebody and flailing punches at them. ![]() Even if the vote went through, and it said "Vote passed, User kicked from server," because they left and returned mid-vote they wouldn't be kicked at all. The problem is, the user with the aimbot was exploiting the vote-kick system by immediately leaving and reentering the game whenever it appeared they were close to getting kicked. I recorded a bunch of videos while spectating, which I will upload here shortly. If you are having any issues, shoot us an email, Contact MPGH Support.Unfortunately, I ran into an aimbotter today for the first time. Ads are removed, almost completely ad free browsing. ein Blick in die FAQ Features: Aimbot (Aimkey LShift) Autofire.It lets you flip, dive and slide, peppering enemies with slow-mo fire from. I opened the game and went to options to enable VR mode after looking up how to do it. I was pretty confused when I saw this because I thought it wasnt a VR game. Let your voice be heard! You can post, reply, and share whatever is on your mind. The packed-action shooter moda spiritual successor to Half-Life 1's The Specialistsis now available for download. So I was looking through my library and saw Double Action: Boogaloo in the VR section.Active marketplace for gamers and people like you, with thousands of contributors and over half a million posts.Interact with our great community, and make new friends with our members.Free access to tutorials, resources, information, tools, trainers, cheats and hacks.Access to our large gaming community with millions of discussions to participate in.REGISTER now for full benefits of our site, it's completely FREE to join: With several hundred thousand FREE hacks, cheats and bots, over 4 million members strong, a free and open marketplace and a great community, what else is there to ask for? Hacks & Cheats, Call of Duty Hacks & Cheats, Gunz Hacks & Cheats, Quake LIVE Hacks & Cheats, WolfTeam Hacks & Cheats, America's Army Hacks & Cheats, Battlefield 2/2142 Hacks & Cheats, Battlefield Heroes Hacks & Cheats, Battlefield Bad Company 2 (BC2) Hacks & Cheats, Battlefield 3 (BF3) Hacks & Cheats, Maplestory Hacks & Cheats, Diablo 3 Hacks & Cheats, Starcraft 2 Hacks & Cheats, Heroes of Newerth Hacks & Cheats, Call of Duty Hacks & Cheats, Call of Duty 4 Hacks & Cheats, Modern Warfare Hacks & Cheats, Modern Warfare 2 Hacks & Cheats, Call of Duty Modern Warfare 3 Hacks & Cheats, Project Blackout Hacks & Cheats, Runescape Hacks & Bots, Minecraft Hacks & Mods, MAT Hacks & Cheats, All Points Bulletin Hacks & Cheats, Vindictus Hacks & Cheats, Dragon Nest Hacks & Cheats, DayZ Hacks & Cheats, WarZ Hacks & Cheats, Arctic Combat Hacks & Cheats, Black OPS 2 Hacks & Cheats, BlackLight Retribution Hacks & Cheats, Bullet Run Hacks & Cheats, All Points Bulletin Hacks & Cheats, Arctic Combat Hacks & Cheats, Warframe Hacks & Cheats, Crysis 3 Hacks & Cheats, Warface Hacks & Cheats, Realm of the Mad God Hacks & Cheats, War Thunder Hacks & Cheats, Call of Duty Ghosts Hacks & Cheats, Battlefield 4 Hacks & Cheats and cheats and trainers for many other multiplayer games. Welcome to MPGH - MultiPlayer Game Hacking, the world's leader in Game Hacks, Game Cheats, Trainers, Combat Arms Hacks & Cheats, Crossfire Hacks & Cheats, WarRock Hacks & Cheats, SoldierFront Hacks & Cheats, Project Blackout Hacks & Cheats, Operation 7 Hacks & Cheats, Blackshot Hacks & Cheats, A.V.A. ![]() Please note that this tutorial will use MongoDB as the database management system and Nginx as the webserver. To obtain and subsequently renew a free SSL certificate, we will use the Let’s Encrypt certification authority, as well as the Certbot software client, which is designed to make it as easy as possible to obtain and renew a certificate through the Let’s Encrypt certification authority. We connect to the server on which you plan to install Rocket.Chat. ![]()
As can be seen from the table the text "DNA" would be represented by the three numbers: 68, 78, 65. Normally a derivative of ASCII encoding is used - see the table below. How each numerical value is interpreted can potentially be different, and this is known as encoding. In the most widely used type of text files ("old school" text) each letter is represented by one byte (8 bits) = 256 possible symbols. Even worse there is no standard way to ignore this extra information - meaning an MS Word file CANNOT be used as input to our sequence analysis programs.ĭifferent interpretations of "plain text".A lot of irrelevant information is added (visualized below): We simply don't care if the DNA sequence is in BOLD or a fancy font.There exists a number of file formats that can contain text - usually in a nicely formatted matter, with embedded graphics and other fancy features. Rich text / MS Word / Word Perfect / etc. There are two main concerns when speaking about text files: ![]() How difficult can it be? Text is text, right? That way will be easy to use the data as input for different kinds of programs, and write simple scripts (small programs) that reads some kind of input, performs some sort of analysis and outputs the result in a readable manner. The main idea is to keep everything simple and open. The same approach is usually also used for other kinds or data - lists of gene names, statistics on DNA patterns etc. ![]() GCACCATGGCTCCGACCAGGTCCGCAACCACGGCAAGAAGGTGTTGGCCGCCTTGGGCAACGCTGTCAAGĪGCCTGGGCAACCTCAGCCAAGCCCTGTCTGACCTCAGCGACCTGCATGCCTACAACCTGCGTGTCGACCĬTGTCAACTTCAAGCTGCTGGCGCAGTGCTTCCACGTGGTGCTGGCCACACACCTGGGCAACGACTACACĬCCGGAGGCACATGCTGCCTTCGACAAGTTCCTGTCGGCTGTGTGCACCGTGCTGGCCGAGAAGTACAGA GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCCCACTTCGACTT For example:ĪTGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG In bioinformatics it's very common to have the data hosted in simple plain text format. 4.2 Search and Replace & Block selection.4.1 On file extensions and default programs.2.2 Different interpretations of "plain text".2 How difficult can it be? Text is text, right?.1 Background: data in plain text format. ![]() Participation from Market Makers and ECNs is strictly voluntary and as a result. ET) and the After Hours Market (4:00-8:00 p.m. Our research shows that the top 50% of the Zacks-ranked industries outperform the bottom 50% by a factor of more than 2 to 1. Investors may trade in the Pre-Market (4:00-9:30 a.m. In terms of the Zacks Industry Rank, Automotive - Original Equipment is currently in the bottom 33% of the 250 plus Zacks industries. Investors should be mindful of the fact that the outlook for the industry can have a material impact on the performance of the stock as well. The current consensus EPS estimate is -$0.22 on $16.37 million in revenues for the coming quarter and -$0.77 on $42.38 million in revenues for the current fiscal year. ) Non-GAAP adjustments: Stock-based compensation Stock-based compensation. It will be interesting to see how estimates for the coming quarters and current fiscal year change in the days ahead. You can see the complete list of today's Zacks #1 Rank (Strong Buy) stocks here. So, the shares are expected to perform in line with the market in the near future. While the magnitude and direction of estimate revisions could change following the company's just-released earnings report, the current status translates into a Zacks Rank #3 (Hold) for the stock. Investors can track such revisions by themselves or rely on a tried-and-tested rating tool like the Zacks Rank, which has an impressive track record of harnessing the power of earnings estimate revisions.Īhead of this earnings release, the estimate revisions trend for Luminar Technologies, Inc. Not only does this include current consensus earnings expectations for the coming quarter(s), but also how these expectations have changed lately.Įmpirical research shows a strong correlation between near-term stock movements and trends in earnings estimate revisions. NASDAQ does not use this value to determine compliance with the listing requirements.There are no easy answers to this key question, but one reliable measure that can help investors address this is the company's earnings outlook. ![]() "Market Cap" is derived from the last sale price for the displayed class of listed securities and the total number of shares outstanding for both listed and unlisted securities (as applicable). It does not include securities convertible into the common equity securities. Market Cap (Capitalization) is a measure of the estimated value of the common equity securities of the company or their equivalent. Register for your free account today at. Amy Smith - Luminar’s Head of Investor Relations. ![]() Data Link's cloud-based technology platform allows you to search, discover and access data and analytics for seamless integration via cloud APIs. (NASDAQ:LAZR) Q1 2023 Earnings Conference Call 5:00 PM ETCompany Participants. Real-time Data is provided using Nasdaq Last Sale Dataĭata provided by Nasdaq Data Link, a premier source for financial, economic and alternative datasets.Investors who anticipate trading during these times are strongly advised to use limit orders. Stock prices may also move more quickly in this environment. Participation from Market Makers and ECNs is strictly voluntary and as a result, these sessions may offer less liquidity and inferior prices. Investors may trade in the Pre-Market (4:00-9:30 a.m. This data feed is available via Nasdaq Data Link APIs to learn more about subscribing, visit Nasdaq Data Link's products page. Significantly high institutional ownership implies Luminar Technologies' stock price is sensitive to their trading actions A total of 7 investors have a majority stake in the company with 51. Real-time bid and ask information is powered by Nasdaq Basic, a premier market data solution. ![]() You can use the bid-ask spread to determine whether to place a market order or limit order when trading, helping you to optimize your price and have a successful order execution. In contrast, a larger spread suggests lower liquidity, as there are fewer investors willing to negotiate. Often, a smaller spread suggests higher liquidity, meaning more buyers and sellers in the market are willing to negotiate. The bid-ask spread can indicate a stock’s liquidity, which is how easy it is to buy and sell in the marketplace. The data displayed in the quote bar updates every 3 seconds allowing you to monitor prices in real-time. The bid size displays the total amount of desired shares to buy at that price, and the ask size is the number of shares offered for sale at that price. The numbers next to the bid/ask are the “ size”. amount that a seller is currently willing to sell. The bid is the highest amount that a buyer is currently willing to pay, whereas the ask is the lowest The bid & ask refers to the price that an investor is willing to buy or sell a stock. I feel like the coronavirus coupled with everything we've been seeing out on the streets, on a civil rights front, has exposed a lot of cracks in a system that feels in pretty dire need of repair. And it felt like that to me even before this past year. Trying to keep steady in a world that feels so chaotic. And it looks different than what it would look like I think if I didn't have kids. I'm a dad, my kids are almost 8 and 12, and so I feel like I kind of see the world a lot of times through their eyes. Questions about our obligations to one another. MT: Like I mentioned a couple minutes ago, questions about spirituality and what place that occupies in my life. IF YOU FEEL COMFORTABLE SHARING, I'D LOVE TO HEAR ABOUT THAT, AND YOUR PROCESS FROM FEELINGS TO WRITING. ![]() WHAT ARE TYPICALLY THE SORTS OF TOPICS YOU WRITE YOUR MUSIC ABOUT? I SEE A LOT OF EMOTIONAL LYRICS WITHIN YOUR MUSIC. So, I had a lot of time to sit with my thoughts and my instruments and come up with this thing that feels uninterrupted, maybe. I did a lot of writing that wasn't interrupted by having to play shows. I was just at home here, in this room I'm sitting in actually. But I think this record feels really condensed because I wasn't traveling at all. They're about questions about spirit, and about what our obligations are to each other as humans. MT: To be honest, I am continually working with the same themes on my records. HOW IS THIS DIFFERENT FROM THE REST OF DISCOGRAPHY? WHAT'S SPECIAL ABOUT THIS ALBUM? THE BAND HAS A NEW ALBUM RELEASING IN JUNE WHICH I READ IS KIND OF A PICTURE OF YOUR LIFE THESE PAST 5 YEARS. I think we need to find those places, certainly right now. But I think it's important to do that, to be able to do that, or start to do that. Speaking truth out into the world, standing up for what you really think and not backing down from that can put you in a vulnerable place. I think part of the inspiration for that song was the ways of telling the truth and speaking the truth. THE BAND'S TOP SONG, "SANCTUARY" THAT WE PLAY ON WERS, CAN YOU TALK A LITTLE BIT ABOUT THE INSPIRATION AND DRIVE BEHIND THAT ONE? People aren't really going to mistake my music for reggae, but that's what I listen to a lot of. That's stuff I feel really connected to and that sort of musical influence comes into my own music in sideways ways. Everybody from King Tubby to Freddie McGregor to Marsha Griffiths, Cornell Campbell. That's what I spend most of my time listening to. ![]() You know, roots reggae which is kind of like devotional reggae or dub reggae. My favorite era is the 1970s-1980s which is most of what I listen to and buy. I think he was an amazing songwriter and had a really incredible touch when it comes to rhythm. MT: I love Curtis Mayfield, he's a really big one for me. WHO ARE SOME OF YOUR MUSICAL INSPIRATIONS OF THE PAST OR PRESENT? ![]() ![]() I get a lot of questions about it and I don't really have a great answer. It just kind of exists in this mysterious sort of universe. I was still playing in another band, so it was sort of my side thing. That's when the earliest Hiss Golden Messenger shows started happening. I started using the name probably about 2006 I would say. MT: It's a name that I came up with when I was still living in San Francisco at the time. HOW DID THE NAME HISS GOLDEN MESSENGER COME TO BE? I FIND IT VERY INTERESTING. Like when I make music and listen to my own music as I'm working on it, it has to feel emotionally believable to me. Soulful to me means something that feels emotionally genuine. But I feel like I am just trying to make music that feels soulful. I feel connected to some of that music, or parts of it. I understand why people say that it's folk or a lot of times Americana. I KNOW YOUR BAND'S GENRE LISTED ON MUSIC PLATFORMS IS FOLK, BUT IF YOU COULD PUT AN ADJECTIVE TO DESCRIBE YOUR TYPE OF FOLK MUSIC, WHAT WOULD THAT WORD BE? They talked about everything from the upcoming release to the band's origins, inspirations and musical process. Taylor recently sat down with staff writer Kelsey Sidman. North Carolina-based folk group Hiss Golden Messenger is set to release their latest studio album, Quietly Blowing It, next month. ![]() Once you order your truck, Stripes & Stuff can start helping you with your concept. You can order graphics through Stripes & Stuff and install them on your own if you wish. They collect half down to start the process, and the other half before your truck is delivered to Prime. Stripes & Stuff offers a few payment options, so you can set up an arrangement that works for you. How much does it cost to wrap a semi-truck? You may be looking at $3,000 to $4,000 depending on the design and style. If you want to add the name and logo of your LLC, that’s going to be around $140 to $180. Those that require more design work and cover a larger portion of the truck will be more expensive.Ī simple door name costs only $10. The cost of custom decals and graphics depends on the size of the project. Prime wants to ensure that graphics and themes are professional as each truck represents the company while crisscrossing the country hauling freight. ![]() Keep in mind that each custom design must be approved by Prime prior to Stripes & Stuff applying the graphics. These are just a few of the designs Prime drivers have created. A dedication to the 9/11 firefighters who lost their lives. The designers at Stripes & Stuff will work with you to fine tune and finalize your design.Ī mythical Kraken with tentacles wrapping around the truck. Need a graphic that matches your tattoo? Done. Want to put your grandchildren’s artwork on your truck? No problem. You can start with a simple sketch, artwork or an idea. What Decals & Graphics Can I Put on my Truck?įrom design to application, Stripes & Stuff has got you covered. ![]() Being an independent contractor at Prime gives you more say in which loads you run, the time you take off, and the truck you drive. The Success Leasing program offers standard lease and lease purchase options for those looking to become owner-operators. Once you lease for at least 3 months with Success Leasing, you can order a custom truck and choose the model and color of your truck, as well as the display graphics that express your personality. It’s one of the benefits of becoming an independent contractor. Who Can Customize Their Truck?Ĭustom semi-truck decals, wraps and lettering are reserved for independent contractors at Prime Inc. Whether you want to highlight your favorite cause, singer or TV show, Stripes & Stuff can bring your vision to life. We’ve worked with Stripes & Stuff for over three decades to help our independent contractors make their trucks unique. The best part? They’re located right down the road from our Springfield, MO terminal. Stripes & Stuff specializes in fleet graphics and detailing, offering custom wraps and decals for semi-trucks. At Prime, you can turn a simple idea into the truck of your dreams. Why not make it reflect you? Custom graphics show off your interests and personality. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |